Genética molecular en el caballo

Genética molecular en el caballo

Publicado por


Genes del caballo

Cada individuo tiene las instrucciones para su funcionamiento en unas unidades llamadas genes, desde las bacterias hasta el hombre, por ahora no es posible ver los genes directamente, pero si se puede reconocer su presencia gracias a su funcionamiento (fenotipo) y, además, en muchas ocasiones podemos medirlo.

Los organismos están compuestos por células y cada célula tiene dos genes, de los cuales, de los cuales uno es derivado del padre y el otro de la madre, como se explicó anteriormente, cada uno de los cuales tiene información similar en la relación con la característica que codifican, pero no necesariamente idéntica. Es así como cada gen puede tener la información para la existencia de pelo y uno lo puede tener liso y el otro gen rugoso, entonces podemos hablar que en cada gen existen por lo menos dos alelos, cuando estos son iguales se dice que el animal es homocigoto, cuando son diferentes heterocigoto.

En el caso de los 7 genes para el color de los equinos, es necesario recordar que cada animal posee dos alelos, uno de los ejemplos más interesantes tiene que ver con el color del pelaje, cuya expresión es el resultado de la interacción de 7 genes, las diferencias observadas son encontradas por personas entrenadas para la observación, para muchos de los alelos uno no puede saber mediante la observación del animal si es o no homocigoto para la presentación de un color.

Los genes Estonia localizados en los cromosomas del núcleo celular, son visibles solamente en la metafase de la mitosis, gracias a ello podemos saber con certeza dónde están los genes en los cuales tenemos interés.

Estos cromosomas están compuestos de ácido desoxirribonucleico (ADN) que es la molécula universal de la herencia, éste a su vez está compuesto por nucleótidos que tienen como identidad la base nitrogenada que los compone. Así pues el material genético de un individuo es la sucesión de Guanina (G), Citosina (C), Timina (T), Adenina (A). Devolviéndonos, los cromosomas tienen millones de pares de bases, localizadas linealmente y de esta secuencia depende el funcionamiento de los individuos, solamente el 5% corresponde a genes que podemos ver en forma de fenotipo, el resto no tiene función al menos por ahora conocida, pero no quiere decir que no tengan función o que no puedan ser usadas, existen algunas secuencias muy importantes que son repeticiones específicas llamadas microsatélites que son utilizadas para la identificación de los individuos, la mayoría de ellos son repeticiones de dos bases como en el ejemplo: (…TCAGGTCTACACACACACACACACACACATGCTTATGACT…), se puede observar que CA se repite alrededor de 10 veces.

Los genomas de mamíferos contienen miles de estos marcadores, que gracias a su gran variación permiten identificar los individuos lo que le da gran potencial de uso entre ellos: paternidad, ciencias forenses, diagnóstico de enfermedades hereditarias e infecciosas.

Marcadores molecularas en caballos

La identificación de los marcadores moleculares están basados en la utilización de la técnica de la reacción en cadena de la polimerasa (PCR) y la digestión de los mismos mediante el uso de endonucleasas separando posteriormente los fragmentos mediante la electrofóresis, esta metodología que aquí planteamos para producción animal también se utiliza para el estudio de la distancia genética y variación poblacional, patrones de historia biogeográfica y pruebas de paternidad.

Dentro de los aspectos de la cría de animales como industria se debe tener en cuenta que cada día, los productos (animales) han de satisfacer las necesidades de los clientes, para el caso el andar, el pelaje, la certeza de la filiación, la salud de los animales. Es en este contexto, donde el mejoramiento debe ser entendido, así pues debemos estar seguros que un animal tiene un paso definido y si esto es cuantificable mucho mejor, que tiene una capa de pelaje específica que es hijo de quien queremos. Es sólo, con objetivos que se puede lograr, cada instante se tienen muchas posibilidades, el criador escoge una de ellas y se ayuda de las herramientas existentes.

Hasta hoy, los programas de cría animal se han basado en la recolección cuidadosa de observaciones de características relacionadas con la producción (leche, carne, huevos, proteína, peso al nacimiento, ganancia diaria, etc.). Estos registros son analizados mediante sistemas estadísticos y biométricos con el ánimo de identificar los animales con efecto positivo o negativo sobre estas características de importancia económica en los sistemas de producción dentro de unapoblación. Este sistema que se ha usado por años ha permitido avances insospechados en selección, especialmente en los machos; hoy en el inicio del siglo XXI, urge el desarrollo y aplicación de nuevos sistemas de selección que ayuden a complementar los existentes.

Para mejorar los equinos colombianos es necesario utilizar nuevos sistemas que complementen los métodos de crianza existentes. Los adelantos en genética molecular han desarrollado técnicas útiles en mejoramiento, una de éstas es la Selección Asistida por Marcadores Genéticos (MAS) la cual permite evaluar características deseadas directamente sobre el material genético de animales nacidos y por nacer; esta técnica se perfila como la opción para la selección de animales de este siglo. La utilización de esta técnica, adicionada al uso de nuevas técnicas de reproducción (transferencia de embriones, inseminación artificial, clonaje, transgénesis) permite que rápidamente se puedan producir hatos enteros con características genéticas de producción deseables.

El mejoramiento genético en la cría de animales, se ha dado gracias al desarrollo de sistemas estadísticos sofisticados que analizan la información sobre características productivas de interés. Estas técnicas han sido de gran ayuda, en el rápido cambio de las tazas de mejoramiento genético en las poblaciones. Estas son consideradas formas de acercamiento al material genético, en lo que se pudiera considerar una caja negra, ya que no se basan en el análisis directo de los genes que controlan las características. Los rápidos desarrollos han permitido salir de esta caja y entrar al conocimiento directo de los genes. De los 70000 genes existentes, el 95% no tienen función conocida. Para algunas características relacionadas con variación genética, es complicado identificar a los genes responsables pues usualmente es más de uno. Algunas veces, para acercarse a estos genes se han utilizado los marcadores genéticos llamados microsatélites. Otro concepto desarrollado, y descubierto en los últimos años, fue el de los polimorfismos, en los que dentro del mismo gen o marcador existen diferencias identificables en sus secuencias, en las 7 diferentes formas de la hemoglobina o 6 formas de almidón.

La mayoría de las características de importancia en selección de animales domésticos para producción de alimento son cuantitativas, como consecuencia del fenotipo observado es el resultado de la acción de los genes responsables con el medio ambiente. El mapeo de estos genes o locus de características cuantitativas (QTL), está asociado al desarrollo de los marcadores genéticos que faciliten su localización. Una alternativa para hacer este tipo de análisis es explotar la asociación que puede existir entre algunas características monogénicas y su asociación con el QTL sobre el que se hace la selección.

Esta asociación puede venir de la estratificación de la población en donde se observe el efecto pleiotrópico del gen sobre ambas características. Algunos ejemplos de ello son la asociación observada entre la hipercalcemia paralítica periódica y el desarrollo muscular en los caballos cuarto de milla, hipertermia maligna y el síndrome de stress porcino y la míelo encefalopatía degenerativa proliferativa (enfermedad de weaver) y la producción láctea.

La producción láctea, es el resultado de la acción de varios genes, esto significa que los fenotipos tienen una distribución continua como resultado del funcionamiento de varios QTL que en ocasiones se confunden con los factores medioambientales. Esta producción tiene una alta heredabilidad (25 – 50%). Se conoce además los mecanismos de regulación de su expresión tales como tejido, sexo, estado y edad.

La información genética recopilada acerca de los caballos podría permitir a los criadores seleccionar características que estén ligadas a un gen o características múltiples genes como la fertilidad y las características de desempeño, como un andar determinado, el color, el brío y la alzada, las cuales hacen parte de la selección genética de un ejemplar ideal para cualquier criador.

Genética del Paso

caballo de paso

Muchas razas de caballos son distinguidas por determinadas características, ejemplo de ello son las razas seleccionadas por su habilidad para cabalgar, como es el caso de nuestro paso fino colombiano. Estas características son transmitidas genéticamente, pero parecen no estar codificadas por un único gen. La herencia del andar no se ha establecido todavía, pero se conocen dos hipótesis: El andar está enmarcado en la herencia poligénica donde una característica está influida por más de un gen; en este tipo de herencia, un carácter puede ser controlado por genes de diferentes locus actuando en forma aditiva; esto es mesurable y está influido por la genética, pero también por el medio ambiente. La comprensión de las características de desempeño depende de la capacidad para identificar y medir los efectos genéticos y ambientales por separado.

Otros autores han sugerido que existen dos genes que producen los diferentes tipos de andares conocidos, un gen del paso con su gen modificador cuya herencia es similar a la de los alelos múltiples.

En la herencia del paso fino, algunos autores basados en la crianza de caballos han afirmado que este aire es heredado y no aprendido, ya que se distingue de otras razas, además porque los ejemplares exhiben desde potro el andar y no necesitan implementos artificiales o de entrenamiento para realizarlos.

Es así como la evaluación cuidadosa de los marcadores genéticos permitirá proveer información sobre la existencia de marcadores que estén asociados a uno u otro andar para ser utilizados en selección.

Las pruebas de paternidad nacieron en la evaluación de los grupos sanguíneos de los animales, dado el gran polimorfismo existente en ellos.

Estas pruebas se hacen mediante evaluación del ADN de los individuos, y se basan en la comparación de las secuencias de los microsatélites, de los padres con las de los hijos. De las muestras se extrae el ADN, que se amplifica y se obtiene un perfil electroforético de la muestra que se quiere analizar y esta se compara con el perfil existente de los padres, bien sea porque se tomó la muestra al tiempo o por la existencia del dato en el banco de ADN, y de esta comparación se da una respuesta sobre la filiación, que es 100% segura en cuanto a la exclusión y 99.9% segura en cuanto a la inclusión, es por esto que se deben comparar. Las pruebas han sido diseñadas, en número de marcadores y en calidad de los mismos para que lleguen al 100%.

Así pues, la prueba se basa en la comparación de los resultados anteriormente mostrados con los del padre, y gracias a la combinación de todos los marcadores, el conocimiento de su frecuencia en la población se pueden asignar los valores de exactitud anteriormente mencionados.

Genética de las Enfermedades.

Existe una prueba para la Parálisis por Hipercalcemia Periódica en los animales. Esta enfermedad ha sido reportada en algunas líneas de caballos cuarto de milla y apaloosa, los animales usualmente muestran una musculatura bien desarrollada, está caracterizada por ataques de contracciones musculares, con complicaciones de las vías aéreas que pueden eventualmente causar la muerte. Se ha identificado la mutación en el gen que regula los niveles musculares de sodio y potasio que produce la proteína anormal, así que se pueden identificar los animales que la posean y tomar decisiones frente a la selección de los mismos.

Descarga genética molecular en caballos

Otros artículos de caballos

Razas de caballos

Recibe todos nuestros artículos en tu correo, suscribete gratis

Mas Información

Dejar un comentario

Tu dirección de correo electrónico no será publicada.